ID: 1054350662_1054350676

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1054350662 1054350676
Species Human (GRCh38) Human (GRCh38)
Location 9:64015332-64015354 9:64015367-64015389
Sequence CCCTGGGCTCAAACCAGGGATGC GGCCCAGCGCAGGGTCTGATGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!