ID: 1054463986_1054463993

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1054463986 1054463993
Species Human (GRCh38) Human (GRCh38)
Location 9:65481724-65481746 9:65481767-65481789
Sequence CCTCTGTGAAGGCGGCCACTTGA TGTCACACCCGGCAGTGCACAGG
Strand - +
Off-target summary {0: 5, 1: 0, 2: 0, 3: 6, 4: 82} {0: 5, 1: 1, 2: 2, 3: 9, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!