ID: 1054505828_1054505835

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1054505828 1054505835
Species Human (GRCh38) Human (GRCh38)
Location 9:65911051-65911073 9:65911079-65911101
Sequence CCTTCTTTTTTGAGCTCCATCCC GGCACTGATGTGATGCCAGCAGG
Strand - +
Off-target summary No data {0: 7, 1: 2, 2: 18, 3: 81, 4: 331}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!