ID: 1054541420_1054541433

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1054541420 1054541433
Species Human (GRCh38) Human (GRCh38)
Location 9:66268899-66268921 9:66268952-66268974
Sequence CCCACAAACTTCAAATTCAACTC TAGTGGCCCGACGCGCACCCTGG
Strand - +
Off-target summary {0: 6, 1: 0, 2: 14, 3: 20, 4: 210} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!