ID: 1054557029_1054557034

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1054557029 1054557034
Species Human (GRCh38) Human (GRCh38)
Location 9:66667173-66667195 9:66667203-66667225
Sequence CCATTCCCTTGGTGCTGTTCTCA GGGTGCCTTCTCATGAGATCTGG
Strand - +
Off-target summary No data {0: 5, 1: 1, 2: 51, 3: 834, 4: 2052}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!