ID: 1054606685_1054606688

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1054606685 1054606688
Species Human (GRCh38) Human (GRCh38)
Location 9:67187970-67187992 9:67188012-67188034
Sequence CCTTCTTTCCTAGAGAACTTCAG AGCCTTCAACTGATTGGATGAGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 1, 3: 30, 4: 223} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!