ID: 1054634662_1054634672

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1054634662 1054634672
Species Human (GRCh38) Human (GRCh38)
Location 9:67477415-67477437 9:67477459-67477481
Sequence CCCCAAATGCCTTTATCCTAGGC CCTAGGATAAAGTAGTACACAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 0, 3: 8, 4: 127} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!