ID: 1054642950_1054642954

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1054642950 1054642954
Species Human (GRCh38) Human (GRCh38)
Location 9:67561074-67561096 9:67561088-67561110
Sequence CCACTTTCTGCCATGAGTGGAAG GAGTGGAAGCAGCATGAGGGAGG
Strand - +
Off-target summary No data {0: 3, 1: 0, 2: 4, 3: 36, 4: 433}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!