ID: 1054660579_1054660589

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1054660579 1054660589
Species Human (GRCh38) Human (GRCh38)
Location 9:67699043-67699065 9:67699096-67699118
Sequence CCTGATCCCTTCCGACAGGCTCA CACCTAGGAGTTCCCCAGTGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!