ID: 1054676107_1054676113

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1054676107 1054676113
Species Human (GRCh38) Human (GRCh38)
Location 9:67857935-67857957 9:67857959-67857981
Sequence CCCATCCCAGTTCCACAGAGAAC CAACCACTATGGCCCCTGAGCGG
Strand - +
Off-target summary {0: 5, 1: 0, 2: 1, 3: 16, 4: 209} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!