ID: 1054690519_1054690522

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1054690519 1054690522
Species Human (GRCh38) Human (GRCh38)
Location 9:68318565-68318587 9:68318582-68318604
Sequence CCTTTTTCAAGCTGTATATTTAG ATTTAGAACAATATCCCATGGGG
Strand - +
Off-target summary No data {0: 4, 1: 2, 2: 6, 3: 116, 4: 761}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!