ID: 1054743064_1054743074

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1054743064 1054743074
Species Human (GRCh38) Human (GRCh38)
Location 9:68828060-68828082 9:68828104-68828126
Sequence CCATGTTGTCATTTGTCCGTTGG ACCAGGGCCTTGACTGTCATGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 15, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!