ID: 1054842656_1054842662

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1054842656 1054842662
Species Human (GRCh38) Human (GRCh38)
Location 9:69759981-69760003 9:69760012-69760034
Sequence CCGGGCCGCCGGCGGGAGTTCCG GAGCGCGCGCGCGCGCGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 78} {0: 1, 1: 9, 2: 30, 3: 119, 4: 488}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!