ID: 1054849021_1054849034

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1054849021 1054849034
Species Human (GRCh38) Human (GRCh38)
Location 9:69827541-69827563 9:69827581-69827603
Sequence CCCACTACCATCTGTATGTGTAC TGACATTTTGGTGGGGGTGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 6, 3: 97, 4: 879}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!