ID: 1054895991_1054895996

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1054895991 1054895996
Species Human (GRCh38) Human (GRCh38)
Location 9:70311968-70311990 9:70311999-70312021
Sequence CCTGTATTAGCCTAGCATGGTGG TGTAATCCCAGCTATGCAAGAGG
Strand - +
Off-target summary No data {0: 6, 1: 246, 2: 5927, 3: 73501, 4: 169179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!