ID: 1055000746_1055000753

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1055000746 1055000753
Species Human (GRCh38) Human (GRCh38)
Location 9:71446817-71446839 9:71446837-71446859
Sequence CCCTCCACTTCTTCCCCATGAGA AGAAGTTCGCCTCCCTCGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 353} {0: 1, 1: 0, 2: 0, 3: 5, 4: 58}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!