ID: 1055018214_1055018225

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1055018214 1055018225
Species Human (GRCh38) Human (GRCh38)
Location 9:71642156-71642178 9:71642191-71642213
Sequence CCTGAATGATTCAAAAGAGCCAA ATGGGGGAGCAGGAAGAGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 16, 3: 241, 4: 1941}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!