ID: 1055018448_1055018454

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1055018448 1055018454
Species Human (GRCh38) Human (GRCh38)
Location 9:71644189-71644211 9:71644211-71644233
Sequence CCAGTGGGAGGATTGCTTCACCC CTGGGAGTTTGAGACCAGGCTGG
Strand - +
Off-target summary No data {0: 6, 1: 406, 2: 3797, 3: 31541, 4: 102696}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!