ID: 1055069316_1055069321

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1055069316 1055069321
Species Human (GRCh38) Human (GRCh38)
Location 9:72149879-72149901 9:72149914-72149936
Sequence CCCAGAAGTCGGGAGCAGTGGCG AACTGGCTCGACAGCAGTCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 134} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!