ID: 1055080632_1055080641

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1055080632 1055080641
Species Human (GRCh38) Human (GRCh38)
Location 9:72265038-72265060 9:72265075-72265097
Sequence CCTGCTTCAGAGGAAGGTCAGAG CTACCTCAGGGGAGATGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 12, 2: 46, 3: 105, 4: 303} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!