ID: 1055086129_1055086138

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1055086129 1055086138
Species Human (GRCh38) Human (GRCh38)
Location 9:72315831-72315853 9:72315875-72315897
Sequence CCTGAGCCACAGAAATCAAAGGG TGATCAACGTGTAAACAAAGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!