ID: 1055095444_1055095453

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1055095444 1055095453
Species Human (GRCh38) Human (GRCh38)
Location 9:72408659-72408681 9:72408710-72408732
Sequence CCAAAGTGCTGGGATTACAGGCG TCAATAGCTATTACGACCACAGG
Strand - +
Off-target summary {0: 121435, 1: 268139, 2: 223994, 3: 153979, 4: 220861} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!