ID: 1055101791_1055101797

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1055101791 1055101797
Species Human (GRCh38) Human (GRCh38)
Location 9:72473188-72473210 9:72473236-72473258
Sequence CCTTCTTCAGTTTTACACCAAGG AGGCAAATCCTGCTACTCACTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!