ID: 1055128889_1055128893

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1055128889 1055128893
Species Human (GRCh38) Human (GRCh38)
Location 9:72752092-72752114 9:72752119-72752141
Sequence CCTTCAAAATGGTGCCCATGGGC GCTCCCAATCCTTGCACTAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 98} {0: 1, 1: 0, 2: 0, 3: 12, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!