ID: 1055156272_1055156276

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1055156272 1055156276
Species Human (GRCh38) Human (GRCh38)
Location 9:73066702-73066724 9:73066717-73066739
Sequence CCACAGACCTTCTGAAGGAACTG AGGAACTGGATCACTGCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 15, 2: 162, 3: 271, 4: 609} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!