ID: 1055208578_1055208584

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1055208578 1055208584
Species Human (GRCh38) Human (GRCh38)
Location 9:73762564-73762586 9:73762583-73762605
Sequence CCGCCAGTGTTCTCCAGCTAACA AACAGGTTTCAGGCCTCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 17, 3: 43, 4: 206} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!