ID: 1055275786_1055275789

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1055275786 1055275789
Species Human (GRCh38) Human (GRCh38)
Location 9:74613843-74613865 9:74613877-74613899
Sequence CCTGTGTTAATTCACTTCGGATA CTGCATTTACGTTGCTTTAAAGG
Strand - +
Off-target summary {0: 1, 1: 120, 2: 384, 3: 1132, 4: 4134} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!