ID: 1055311444_1055311448

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1055311444 1055311448
Species Human (GRCh38) Human (GRCh38)
Location 9:74985877-74985899 9:74985924-74985946
Sequence CCCTGTAGTATGACTTTAATGTG TAAACAAGGCACTAAGTAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 194} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!