ID: 1055344380_1055344383

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1055344380 1055344383
Species Human (GRCh38) Human (GRCh38)
Location 9:75319294-75319316 9:75319311-75319333
Sequence CCACCCATCTTATATAGGTAATA GTAATACTTTTATTAATTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 99} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!