ID: 1055353919_1055353927

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1055353919 1055353927
Species Human (GRCh38) Human (GRCh38)
Location 9:75418009-75418031 9:75418054-75418076
Sequence CCGGCACTAGGACTGGAGGACTG GCACTAGGACTGGAGGACTGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!