ID: 1055397632_1055397634

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1055397632 1055397634
Species Human (GRCh38) Human (GRCh38)
Location 9:75891512-75891534 9:75891557-75891579
Sequence CCTGCGCGCGCGCGCGTACGCAC ACACACACCCCAGAGTTGCCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 11, 3: 43, 4: 164} {0: 1, 1: 0, 2: 2, 3: 26, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!