ID: 1055495010_1055495012

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1055495010 1055495012
Species Human (GRCh38) Human (GRCh38)
Location 9:76845424-76845446 9:76845454-76845476
Sequence CCTTCTGCTCTGTCACAAAGATA GTGCTTACTTAGTTTAGTTGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!