ID: 1055514324_1055514329

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1055514324 1055514329
Species Human (GRCh38) Human (GRCh38)
Location 9:77020807-77020829 9:77020833-77020855
Sequence CCCGCGGCTTCGCAGCAGCCTCC GCCATCCACCGTGTGCTCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 245} {0: 1, 1: 0, 2: 2, 3: 4, 4: 58}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!