ID: 1055530355_1055530372

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1055530355 1055530372
Species Human (GRCh38) Human (GRCh38)
Location 9:77177575-77177597 9:77177624-77177646
Sequence CCAGCGGGGGCGCCGCAGCTGAA TACCTCGAGGGAGGGGCGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 79} {0: 1, 1: 0, 2: 0, 3: 11, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!