ID: 1055549335_1055549339

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1055549335 1055549339
Species Human (GRCh38) Human (GRCh38)
Location 9:77416426-77416448 9:77416462-77416484
Sequence CCTGAGTGATGGGTAAGAAATCA TGGTATCAAGAGAACTTTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 195} {0: 1, 1: 0, 2: 2, 3: 10, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!