ID: 1055573105_1055573113

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1055573105 1055573113
Species Human (GRCh38) Human (GRCh38)
Location 9:77636688-77636710 9:77636730-77636752
Sequence CCAGCTCTCTCAAGAATACAGTG GGGCACTAATCTATTCTTGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 13, 2: 110, 3: 437, 4: 1301}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!