ID: 1055604493_1055604495

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1055604493 1055604495
Species Human (GRCh38) Human (GRCh38)
Location 9:77954278-77954300 9:77954292-77954314
Sequence CCATGTGCCAAATGGTGTTAGAG GTGTTAGAGAATTCCTGTTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 133} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!