ID: 1055605010_1055605011

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1055605010 1055605011
Species Human (GRCh38) Human (GRCh38)
Location 9:77960032-77960054 9:77960058-77960080
Sequence CCATTTCTTTTTTTTTTATTCAT ATTCTCTTTAACCAAGAGAATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!