ID: 1055611693_1055611713

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1055611693 1055611713
Species Human (GRCh38) Human (GRCh38)
Location 9:78031339-78031361 9:78031380-78031402
Sequence CCCCCGCCGCCCGGGCGCGCGTC CCGCCGCGGGGGCGGCGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 51, 4: 444} {0: 2, 1: 0, 2: 22, 3: 136, 4: 1026}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!