ID: 1055636863_1055636869

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1055636863 1055636869
Species Human (GRCh38) Human (GRCh38)
Location 9:78287549-78287571 9:78287588-78287610
Sequence CCCAGCATTCCTATAGGGTGGAG CTGCTTTTCATGAGAAAACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 80} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!