ID: 1055638317_1055638323

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1055638317 1055638323
Species Human (GRCh38) Human (GRCh38)
Location 9:78298524-78298546 9:78298560-78298582
Sequence CCCTGCTCCAGCTGTGGAGATGT CTCCTGCACCCCCCATGTTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 239} {0: 1, 1: 0, 2: 1, 3: 14, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!