ID: 1055638910_1055638917

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1055638910 1055638917
Species Human (GRCh38) Human (GRCh38)
Location 9:78304220-78304242 9:78304255-78304277
Sequence CCCCCATCTTCTGGCTCTGCTTT CTTCATTGGGTGGCCACCATTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 51, 4: 527} {0: 1, 1: 0, 2: 0, 3: 4, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!