ID: 1055638911_1055638915

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1055638911 1055638915
Species Human (GRCh38) Human (GRCh38)
Location 9:78304221-78304243 9:78304242-78304264
Sequence CCCCATCTTCTGGCTCTGCTTTC TCTTATGTGTTCTCTTCATTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 60, 4: 631} {0: 1, 1: 1, 2: 0, 3: 26, 4: 387}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!