ID: 1055638912_1055638916

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1055638912 1055638916
Species Human (GRCh38) Human (GRCh38)
Location 9:78304222-78304244 9:78304245-78304267
Sequence CCCATCTTCTGGCTCTGCTTTCT TATGTGTTCTCTTCATTGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 67, 4: 574} {0: 1, 1: 0, 2: 0, 3: 8, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!