ID: 1055682006_1055682010

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1055682006 1055682010
Species Human (GRCh38) Human (GRCh38)
Location 9:78724872-78724894 9:78724894-78724916
Sequence CCCTCCAGTGGCAGGGCTACCAC CACACCCATGTATATCTGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 122} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!