ID: 1055757480_1055757482

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1055757480 1055757482
Species Human (GRCh38) Human (GRCh38)
Location 9:79571783-79571805 9:79571803-79571825
Sequence CCAGAGCGCTCGCATGGCGGGCC GCCGGTGATTGTAGTCAATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 50} {0: 1, 1: 0, 2: 0, 3: 1, 4: 25}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!