ID: 1055774311_1055774317

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1055774311 1055774317
Species Human (GRCh38) Human (GRCh38)
Location 9:79751650-79751672 9:79751696-79751718
Sequence CCTTAAAGTTCCAAAATGATCTT GGGTGCGTTGATGCAAGATGTGG
Strand - +
Off-target summary {0: 36, 1: 258, 2: 346, 3: 318, 4: 526} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!