ID: 1055939242_1055939256

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1055939242 1055939256
Species Human (GRCh38) Human (GRCh38)
Location 9:81634186-81634208 9:81634227-81634249
Sequence CCGGCACTGCCCCCGAGGGGCGG TCCCGAAGGGTGAGGCGTAAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 11, 4: 171} {0: 2, 1: 0, 2: 0, 3: 3, 4: 52}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!