ID: 1055960104_1055960108

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1055960104 1055960108
Species Human (GRCh38) Human (GRCh38)
Location 9:81812236-81812258 9:81812271-81812293
Sequence CCACTGCGCCCAGCCTATAAACA GTACCTATTAAAATTAAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 22, 2: 198, 3: 1412, 4: 6304} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!