ID: 1055991505_1055991510

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1055991505 1055991510
Species Human (GRCh38) Human (GRCh38)
Location 9:82111153-82111175 9:82111196-82111218
Sequence CCGGATGGAGTGTGGCCCTGCTA TGATACTGATTTTGGACTTCTGG
Strand - +
Off-target summary No data {0: 11, 1: 41, 2: 100, 3: 210, 4: 586}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!